To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

FAQ's

FAQ Home

Find Answers

Test primers and probe for synthetic Hepatitis C virus RNA VR-3233SD

Which primers and probe did ATCC use to confirm the identity of the synthetic RNA for Hepatitis C, VR-3233SD?

ATCC used the following primers and probe to obtain a positive PCR product from this RNA:

Forward primer: GCA GAA AGC GTC TAG CCA TGG CGT
Reverse primer:CTC GCA AGC ACC CTA TCA GGC AGT
Probe:  CATAGTGGTCTGCGGAACCGGTGAGT 

Date Created08/25/2015 03:43 PM
Date Updated08/25/2015 03:47 PM

Most Popular Answers

  1. Huh7 cell line
  2. ATCC HUVEC lines
  3. Passage number vs. population doubling level (PDL)
  4. Converting TCID[50] to plaque forming units (PFU)
  5. U-373 MG (ATCC® HTB-17)