To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

FAQ's

FAQ Home

Find Answers

Test primers and probe for MERS-CoV synthetic RNA VR-3248SD

Which primers and probe did ATCC use to confirm the identity of the synthetic RNA for MERS-CoV, ATCC VR-3248SD?

ATCC used the following primers and probe to obtain a positive PCR product from this RNA:

upEf (forward primer): GCAACGCGCGATTCAGTT
upEr (reverse primer): GCCTCTACACGGGACCCATA
upEp (Probe): CTCTTCACATAATCGCCCCGAGCTCG

Date Created11/16/2015 03:13 PM
Date Updated11/16/2015 03:16 PM

Most Popular Answers

  1. Huh7 cell line
  2. ATCC HUVEC lines
  3. Passage number vs. population doubling level (PDL)
  4. Converting TCID[50] to plaque forming units (PFU)
  5. U-373 MG (ATCC® HTB-17)