To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Trichoderma virens (Miller et al.) von Arx, anamorph (ATCC® 9645™)

Alternate State: Hypocrea virens Chaverri et al., teleomorph  /  Strain Designations: T-1 [CBS 430.54, DSM 1963, IAM 5061, IFO 6355, IMI 45553, NRRL 2314, QM 365]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichoderma sp.
Verified By Whole-genome Sequencing
Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Hypocreaceae, Trichoderma
Strain Designations T-1 [CBS 430.54, DSM 1963, IAM 5061, IFO 6355, IMI 45553, NRRL 2314, QM 365]
Alternate State Hypocrea virens Chaverri et al., teleomorph
Application
Bacterial resistance testing adhesives
Degrades plastics
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing aircraft transmissions
Fungus resistance testing automotive components
Fungus resistance testing cork
Fungus resistance testing electrical insulation
Fungus resistance testing packing materials
Fungus resistance testing paper and paperboard
Fungus resistance testing plastics
Fungus resistance testing polymers
Fungus resistance testing textiles
Fungus resistance testing varnish
Fungus resistance testing wax
Testing
Testing fungicides on lumber
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Methods D4300-88, D4445-91, and D4783-89 where only the taxon is specified.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Methods D4300-88, D4445-91, and D4783-89 where only the taxon is specified.
Morphology Colonies growing rapidly, 8.0-9.5 cm in diameter after 4 days; aerial mycelium slightly floccose, white to grayish quickly turning dark bluish green from pistachio green with age. Chlamydospores abundantly produced, branching irregularly with each branch terminating with a cluster of 3 to 6 closely appressed phialides. Conidia broadly ellipsoid to obovoid appearing smooth walled, dark green.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC


RNA polymerase II second largest subunit

AAAGAAGCGTCTGGATCTGGCTGGTCCCCTGTTGGCTAAATTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAACTATCTGAGACGTTGCGTCGAGGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCCGGCACACTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCCGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACCCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTGTGTCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAACCACTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCTAGACACTCGTCGCAAATCCTATCTGCAGTATGAAGTCTCTCTCGTGAGAGAGATTCGAGACCAGGAATTCAAAATCTTTTCCGATGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAGGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTAACTAAGGAGCTCGTCAACAGATTGGCTAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGACTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCGATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATCTCTACCGATGAAGACATGGGAGATGATCCGAACAAGCGACTAAAGACGAAGACCAACCCAACAACCCACATGTACACACATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCTAGTATCATTCCTTTCCCCGATCATAACCAGGTATGTCGTCAACCCTTCCGATTTTGCTCTCAAAGCAATTGCTAATGGCGTGCACAGTCCCCCCGTAACACTTACCAATCTGCC


Elongation factor 1-alpha

CTGGTACTTCCCAGGCCGATTGCGCCATTCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACCTCCAACTTCATTAAGAAGGTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGCTCCAGCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATCGGTGGTATCGGAACGGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTTGTTACCTTCGCTCCTTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGTTGAGGGTGTTCCCGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGTCAGGTCGGTGCCGGCTACGCCCCCGTCCTTGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCAGGAGAAGATCGACCGCCGTACCGGTAAGGCTACCGAGACTGCCCCCAAGTTCATCAAGTCCGGTGACTCTGCCATCGTCAAGATGATTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGACTACCCTCCCCTGGGTCGTT
Morphology Colonies growing rapidly, 8.0-9.5 cm in diameter after 4 days; aerial mycelium slightly floccose, white to grayish quickly turning dark bluish green from pistachio green with age. Chlamydospores abundantly produced, branching irregularly with each branch terminating with a cluster of 3 to 6 closely appressed phialides. Conidia broadly ellipsoid to obovoid appearing smooth walled, dark green.
Name of Depositor WH Weston
Isolation
Soil, Maryland
Cross References

Nucleotide (GenBank) : KU729029 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729113 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933456 elongation factor (EF) 1-alpha gene

Nucleotide (GenBank) : KU933428 RNA polymerase II second largest subunit (RPB2) gene

References

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002).

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961

U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Klausmeier RE. Results of the second interlaboratory experiment of biodeterioration of plastics. Int. Biodeterior. Bull. 8: 3-7, 1972.

Klausmeier RE, Jamison EJ. A rapid method for estimation of microbial degradation of plastics. Dev. Ind. Microbiol. 14: 258-263, 1973.

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Standard Test Method for Efficacy of Fungal Control Agents as Preservatives for Aqueous-Based Products Used in the Paper Industry. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 0875-00 (Reapproved 2005).

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
FAQs
  1. Accessing genome sequencing data


    Date Updated: 9/30/2019

  2. Criteria for reference quality genomes


    Date Updated: 9/30/2019