To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 9080™)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: 4228 [ATCC 24904, ATCC 46991, BI CZAS 0323/1, CBS 2354, CCRC 20855, CCY 48-76, DBVPG 6248, DSM 70424, IFO 0565, NCYC 74, NRRL Y-1089, VKM-366, VKPM Y-830, VTT C-66065]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces carlsbergensis Hansen
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations 4228 [ATCC 24904, ATCC 46991, BI CZAS 0323/1, CBS 2354, CCRC 20855, CCY 48-76, DBVPG 6248, DSM 70424, IFO 0565, NCYC 74, NRRL Y-1089, VKM-366, VKPM Y-830, VTT C-66065]
Alternate State Candida robusta Diddens et Lodder
Application
Assay of pantothenic acid
Assay of pyridoxal
Assay of pyridoxamine
Assay of pyridoxine vitamin B6
Assay of vitamin B6 complex
Ferments maltose
Produces alpha-glucosidase maltase
Produces ergosterol
Produces nicotinic acid niacin
Produces pyrophosphatases
Produces yeast proteinase B inhibitor proteinase B inhibitor IB3
Food testing
Produces niacin-related compounds
Produces endo-deoxyribonuclease A
Produces alpha-glucosidase in brewery waste
Reduces 3-methoxy-8(14)-seco-1,3,5(10),9,(11)-estratetraene-14,17-dione
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Ploidy diploid
Comments
Alpha-glucosidase synthesis
NADH oscillations
Spatio-temporal organization
Induction of giant cells
Sterol synthesis
Does not carry 2 micron DNA plasmid.
Genetics and biochemistry
Respiration
Oscillation in glycolysis
Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, smooth, dull, butyrous, margin entire. Cells hyaline, broadly ovoid, smooth, 4.5-9 X 4-6 µm. Pseudohyphae not observed.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TAATTTTGAAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC
Morphology On YM medium at 25°C after 2 days, colonies white to dingy white, smooth, dull, butyrous, margin entire. Cells hyaline, broadly ovoid, smooth, 4.5-9 X 4-6 µm. Pseudohyphae not observed.
Name of Depositor RE Eakin
Isolation Not available
Cross References

Nucleotide (GenBank) : KU729073 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729159 D1/D2 region of 28S rRNA gene

References

Matern H, et al. Isolation, characterization and localization of the proteinase B inhibitor IB3 from Saccharomyces carlsbergensis. Eur. J. Biochem. 101: 325-332, 1979. PubMed: 118002

Hata S, et al. Involvement of cytochrome P-450 in delta22-desaturation in ergosterol biosynthesis of yeast. Biochem. Biophys. Res. Commun. 103: 272-277, 1981. PubMed: 7032523

Gibian H, et al. Production of optically active antipodes. US Patent 3,562,112 dated Feb 9 1971

Ando T, et al. Novel endo-deoxyribonuclease and process for the production thereof. European Patent Office Publ. No. 0060465A2 dated Sep 9 1982

Nishikawa Y, et al. Thiamine-induced alteration in sterol composition of Saccharomyces carlsbergensis 4228. Biochim. Biophys. Acta 531: 86-95, 1978. PubMed: 708751

Baumstark-Khan C, et al. Radiation induced formation of giant cells in Saccharomyces uvarum. II. Effect of X-rays on septum formation. Radiat. Environ. Biophys. 24: 9-16, 1985. PubMed: 3975354

Tubb RS. 2pm DNA plasmid in brewery yeasts. J Inst Brew 86: 78-80, 1980.

Berge AM. Genes for the fermentation of maltose and -methylglucoside in Saccharomyces carlsbergensis. Mol. Gen. Genet. 115: 80-88, 1972. PubMed: 5018453

Lichko L, Okorokov L. Purification and some properties of membrane-bound and soluble pyrophosphatases of yeast vacuoles. Yeast 7: 805-812, 1991. PubMed: 1664997

Baumstark-Khan C, et al. Radiation induced formation of giant cells (Saccharomyces uvarum). I. Budding process and chitin ring formation. Radiat. Environ. Biophys. 23: 19-30, 1984. PubMed: 6709826

Kreuzberg KH, Betz A. Amplitude and period length of yeast NADH oscillations fermenting on different sugars in dependence of growth phase, starvation and hexose concentration. J Interdiscip Cycle Res 10: 41-50, 1979.

. . Adv. Biotechnol. 2: 225-230, 1981.

Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells in a phosphate limited continuous culture. Biotechnol. Lett. 13: 97-100, 1991.

Jacobsen H, et al. Spontaneous spatio-temporal organization in yeast cell suspension. J. Cell Sci. 43: 367-377, 1980. PubMed: 7419625

Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells. Biotechnol. Lett. 12: 277-282, 1990.

Berge AM, et al. Regulation of maltose fermentation in Saccharomyces carlsbergensis. I. The function of the gene MAL6, as recognized by mal6-mutants. Mol. Gen. Genet. 123: 233-246, 1973. PubMed: 4731427

Das J, Busse HG. Analysis of the dynamics of relaxation type oscillation in glycolysis of yeast extracts. Biophys. J. 60: 369-379, 1991. PubMed: 1832975

AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in food extracts, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.15.

AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in ready-to-feed milk-based infant formula, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 985.32.

Shin M, et al. Effect of L-tryptophan and L-leucine on biosynthesis of niacin-related compounds in Saccharomyces carlsbergensis. J. Nutr. Sci. Vitaminol. 28: 179-189, 1982. PubMed: 6215472

Atkin L, et al. Yeast microbiological methods for determination of vitamins. Pyridoxine. Ind. Eng. Chem. 15: 141-144, 1923.

Appleyard JG, Stanley DA. The evaluation of the vitamin B 6 status in children with convulsions. Med. Lab. Technol. 29: 160-170, 1972. PubMed: 5071462

Itagaki T, Tsukahara T. Microbiological assay of vitamin B 6 by thin-layer cup-plate method with Saccharomyces carlsbergensis. J. Vitaminol. 18: 90-96, 1972.

Windevoxhel M, Bahar S. Production of intracellular alpha-glucosidase in brewery waste by Saccharomyces carlsbergensis. Acta Cient. Venez. 40: 40-45, 1989. PubMed: 2700112

Tsuji K. Liquid nitrogen preservation of Saccharomyces carlsbergensis and its use in a rapid biological assay of pantothenic acid. Appl. Microbiol. 14: 462-465, 1966. PubMed: 5970831

van der Zeijst BA, et al. In vitro protein synthesis in yeast polyuridylic acid-dependent incorporations of phenylalanine into endogenous peptidyl transfer RNA. Biochim. Biophys. Acta 294: 517-526, 1973. PubMed: 4705999

de Kroon RA, Koningsberger VV. An inducible transport system for alpha-glucosides in protoplasts of Saccharomyces carlsbergensis. Biochim. Biophys. Acta 204: 590-609, 1970. PubMed: 5441195

Foodstuffs --- Determination of vitamin B6 by microbiological assay. London, UK:British Standards Institution;British Standard DD ENV 14166:2001.

Stolz J, Vielreicher M. Tpn1p, the plasma membrane vitamin B6 transporter of Saccharomyces cerevisiae. J. Biol. Chem. 278: 18990-18996, 2003. PubMed: 12649274

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
Other Documentation
Other Document
Application Note