To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Candida geochares (van der Walt et al.) Meyer et Yarrow (ATCC® 36852™)

Strain Designations: CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis geochares van der Walt et al.
Strain Designations CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]
Application
quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC

Morphology After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- J.P. van der Walt
Isolation
Grassland soil; South Africa
References

van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080

YT MicroPlate QC Set. Biolog.

Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281

Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998.

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS