To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Candida kefyr (Beijerinck) van Uden et Buckley (ATCC® 2512™)

Alternate State: Kluyveromyces marxianus (EC Hansen) van der Walt  /  Strain Designations: [BI CZAS 652/6, CCY 29-8-9]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torula cremoris Hammer et Cordes
Strain Designations [BI CZAS 652/6, CCY 29-8-9]
Alternate State Kluyveromyces marxianus (EC Hansen) van der Walt
Application
Assay of nicotinic acid niacin
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAMGGATGCTGGCGTAATGGTTAAATGCCGC
Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Name of Depositor FW Tanner
Isolation Not known.
References

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Winter WD Jr., et al. Nicotinic acid requirements of Candida pseudotropicalis. J. Bacteriol. 82: 616, 1961. PubMed: 13893828

Williams WL. Yeast microbiological method for determination of nicotinic acid. J. Biol. Chem. 166: 397-406, 1946.

YT MicroPlate QC Set. Biolog.

RapID™ Yeast PLUS QC Set. Remel™.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS