To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Candida albicans (Robin) Berkhout (ATCC® 14053-MINI-PACK)

Strain Designations: NIH 3172  /  Product Format: frozen
6 ready-to-use vials of ATCC® 14053™ in glycerol stock

Permits and Restrictions

View Permits

Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain Designations NIH 3172
Application ATCC® 14053-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 14053™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.  Learn more about ATCC® MinisDeveloped by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go! .

Control strain for identification
Quality control strain
Produces estrogen-binding protein
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
6 ready-to-use vials of ATCC® 14053™ in glycerol stock
Storage Conditions -70°C or colder, store upright. Storage at -20°C is acceptable for up to 1 year.
Preceptrol® no
Comments PCR profile
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATTAACTTGTCACACCAGATTATTACTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


26S ribosomal RNA gene, partial sequence.

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG

Name of Depositor CW Emmons
Special Collection ATCC® Minis
Isolation Human blood, Bethesda, MD
Cross References

Nucleotide (GenBank) : GU319992 D1/D2 region of 26S rRNA gene

Nucleotide (GenBank) : EU266567 ITS including 5.8S rRNA gene

References

Skowronski R, Feldman D. Characterization of an estrogen-binding protein in the yeast Candida albicans. Endocrinology 124: 1965-1972, 1989. PubMed: 2647470

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J Clin Microbiol 34: 615-621, 1996. PubMed: 8904425

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Abbreviated Identification of Bacteria and Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M35-A2.

VITEK 2 YST Streamlined QC Set. bioMerieux.

VITEK 2 YST Comprehensive QC Set. bioMerieux.

RapID™ Yeast PLUS QC Set. Remel™.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation