To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Penicillium rubens Biourge (ATCC® 11709™)

Strain Designations: Wis. 49-133 [NRRL 2272]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium chrysogenum Thom
Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Penicillium
Strain Designations Wis. 49-133 [NRRL 2272]
Application
Produces penicillin
Transformations of uleine
Pharmaceutical and Personal Care
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments High-yielding, sporulating, penicillin strain

The strain was re-identified as Penicillium rubens, a close sister of Penicillium chrysogenum, based on the multigene sequence analysis.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA


beta-tubulin (TUB2) gene

TCCCCTCCAGACGCGTCTTTTGTTTTCATATGGCCCCTGAGCCACGACCCCACCCCCAACAGATCTTTTGCTAACTTGCTCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCAACATGGAACATTCTTGGAAACATTCTTCGATTCGTGGGACTAAACTGGAATTGGGTTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTCTCGGAGCTTTTTTTTTCGCGTTGGGTATCAATTGACAAGTTGCTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTAACAGTGATAGGGATTCTGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACTGGGAATCGATTGATTGTGCATCATCTGATCGGACGTTTTTCTTTGACAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGT
Name of Depositor MP Backus
Isolation
Selected from Wis. 48-701, ATCC 11707, after N-mustard exposure
Cross References

Nucleotide (GenBank) : KU896996 beta-tubulin (TUB2) gene

Nucleotide (GenBank) : HQ026731 ITS including 5.8S rRNA gene

References

Borris RP, Cordell GA. Studies on the uleine alkaloids. III. Some microbial transformations of uleine. J. Nat. Prod. 46: 211-217, 1983.

Backus MP, Stauffer JF. The production and selection of a family of strains in Penicillium chrysogenum. Mycologia 47: 429-463, 1955.

U.S. Pharmacopeia General Chapters: <1072> Disinfectants and Antiseptics. Rockville, MD. USP34-NF29, 2011

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS