To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Quantitative Synthetic Dengue virus type 3 RNA (ATCC® VR-3230SD™)

Product Format: frozen
Specification range: 1 x 105 - 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable

Permits and Restrictions

View Permits

Agent Quantitative Synthetic Dengue virus type 3 RNA
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Specification range: 1 x 105 - 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable
Storage Conditions -70°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes fragments from the capsid, membrane, and envelope regions.

The following primers and probe can be used with this nucleic acid preparation RefCenters for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.:
Forward primer: GGACTRGACACACGCACCCA
Reverse primer: CATGTCTCTACCTTCTCGACTTGYCT
Probe: ACCTGGATGTCGGCTGAAGGAGCTTG
Special Collection RNA
References

Waggoner JJ, et al. Development of an internally controlled real-time reverse transcriptase PCR assay for pan-dengue virus detection and comparison of four molecular dengue virus detection assays. J. Clin. Microbiol. 51(7): 2172-2181, 2013. PubMed: 23637298

Waggoner JJ, et al. Single-reaction, multiplex, real-time rt-PCR for the detection, quantitation, and serotyping of dengue viruses. PLoS Negl. Trop. Dis. 7(4): e2116, 2013. PubMed: 23638191

Centers for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
Other Documentation
Other Document
Microbial Characterization Data Other Document
Application Note